Review



f12 medium diagnocine cat  (TargetMol)


Bioz Verified Symbol TargetMol is a verified supplier
Bioz Manufacturer Symbol TargetMol manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    TargetMol f12 medium diagnocine cat
    F12 Medium Diagnocine Cat, supplied by TargetMol, used in various techniques. Bioz Stars score: 94/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/f12+medium+diagnocine+cat/Coagulation+factor+XII+Protein%2C+Human%2C+Recombinant/pm41666013-611-255-250
    Average 94 stars, based on 25 article reviews
    f12 medium diagnocine cat - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Cell-type-independent infection dynamics of clinical Pseudomonas aeruginosa isolates in human airway epithelial models.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MUC5AC Monoclonal (45M1) Thermo Fisher Cat#MA5-12178; RRID:AB_10978001 CFTR Monoclonal 570 Gift from Cystic Fibrosis Foundation N/A Alexa Fluor Plus 555 Phalloidin Thermo Fisher Cat#A30106 Goat anti-mouse Alexa Fluor 647 Thermo Fisher Cat#A21235; RRID:AB_2535804 Bacterial and virus strains Escherichia coli SM10 helper pBF13, Ampicillin resistant Søren Molin Lab N/A E. coli HB101 helper pRK600, Chloramphenicol resistant Søren Molin Lab N/A E. coli mini-tn7-sfGFP, Gentamicin resistant This study N/A P. aeruginosa PAO1, sfGFP tagged Original strain from DSMZ collection, tagged in this study DSM22644, sfGFP tagged PA14, sfGFP tagged Original strain from DSMZ collection, tagged in this study DSM19882, sfGFP tagged C Clone, sfGFP tagged Original strain from DSMZ collection, tagged in this study DSM29238, sfGFP tagged P. aeruginosa type III secretion (pscC), sfGFP tagged Pedersen et al. 17 N/A P. aeruginosa clinical strains, sfGFP tagged This study See Table S1 Biological samples Nasal swabs, lung biopsies, polyps from CF donors CF Clinic, Rigshospitalet See Table S2 Nasal swabs from non-CF donors Healthy volunteers See Table S2 Chemicals, peptides, and recombinant proteins Primocin InvivoGen Cat#ant-pm-05 Gentamicin/Amphotericin solution Gibco Cat#10184583 Penicillin/Streptomycin Gibco Cat#15140122 PneumaCult TM -Ex Plus Basal Medium and supplements STEMCELL Technologies Cat#05040 Hydrocortisone Stock Solution STEMCELL Technologies Cat#07925 ROCK inhibitor (Y-27632) Tocris Bioscience Cat#1254 TrypLE Gibco Cat#12563011 Collagen I, rat tail Gibco Cat#A1048301 PneumaCult TM -ALI Basal Medium and supplements STEMCELL Technologies Cat#05001 Heparin Solution STEMCELL Technologies Cat#07980 Elexacaftor MedChemExpress Cat#VX-445 Tezacaftor Selleck Chemicals LLC Cat#VX-661 Ivacaftor Selleck Chemicals LLC Cat#VX-770 Forskolin TargetMol Cat#T2939 Genistein TargetMol Cat#T1737 Coon’s modified Ham’s F12 medium DiagnoCine Cat#AT146 HEPES sodium salt solution Sigma Aldrich Cat#H3662 Amiloride Sigma Aldrich Cat#A7410 PPQ-102 CFTR inhibitor Sigma Aldrich Cat#219677 Gentamicin Salt Sigma Aldrich Cat#G3632 Tobramycin Sigma Aldrich Cat#T4014 Ceftazidime Sigma Aldrich Cat#C3809 (Continued on next page) Cell Reports 45, 116951, February 24, 2026 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Ciprofloxacin Sigma Aldrich Cat#17850 Triton X-100 Invitrogen Cat#HFH10 Saponin Thermo Fisher Cat#A18820.14 Phosphate Buffered Saline Gibco Cat#10010023 Bovine Serum Albumin Sigma Aldrich Cat#05470-5G VECTASHIELD® Antifade Mounting Medium VWR Cat#VECTH-1000 RNA protect Cell Reagent Qiagen Cat#76526 Lysozyme Thermo Fisher Cat#89833 β-mercaptoethanol Sigma Aldrich Cat#444203 DNAse I Invitrogen Cat#EN0521 DAPI Thermo Fisher Cat#62248 Critical commercial assays Human IL-8/CXCL8 DuoSet ELISA kit Bio-Techne Cat#DY208 CyQUANT TM LDH Cytotoxicity Assay Thermo Fisher Cat#C20301 Qiagen RNeasy Plus Mini kit Qiagen Cat#74134 Qubit® RNA BR Assay kit Thermo Fisher Cat#Q10210 RNA 6000 Nano kit Agilent Cat#5067-1511 Illumina Stranded Total RNA Prep with Ribo-Zero Plus kit Illumina Cat#20040529 Illumina® RNA UD Indexes Set A, Ligation (96 Indexes, 96 Samples) Illumina Cat#20091655 Deposited data RNA raw sequences (NCBI BioProject) This study PRJNA1153754 Experimental models: Cell lines BCi-NS1.1 cell line Gift from Ronald Crystal Lab (Walters et al. 39 ) N/A Experimental models: Organisms/strains ALI models generated from basal airway cells derived from non-CF and CF and cell line CF Clinic Rigshospitalet and Healthy volunteers See Table S2 Oligonucleotides sfGFP_SacI_For: CATGAGCTCTTGACAA TTAATCATCCGGCTCGTATAATCCTAGG CCGCGACGCATGTTTAG This study N/A sfGFP_KpnI_Rev: GCGAGGTAC CACCCCTGGATTCTCACC This study N/A Software and algorithms JMP Version 17.2 Statistical Discovery LLC https://www.jmp.com/en/offers/ statistical-analysis-software GraphPad Prism Version 10.2.2 GraphPad https://www.graphpad.com/ Computerome Version 2.0 Technical University of Denmark https://computerome.dk/ R Version 2024.04.2 R Studio https://dailies.rstudio.com/version/ 2024.04.2+764/ LasX Version 1.4.4.26810 Leica Microsystems https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/downloads/ Imaris Version 10.1.0 Oxford Instruments https://imaris.oxinst.com/versions/10-1 Other 6.5mm Transwells inserts (0.4 μm pores) Corning Life Sciences Cat#3470 16 Cell Reports 45, 116951, February 24, 2026

    Recombinant:

    Article Title: Cell-type-independent infection dynamics of clinical Pseudomonas aeruginosa isolates in human airway epithelial models.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MUC5AC Monoclonal (45M1) Thermo Fisher Cat#MA5-12178; RRID:AB_10978001 CFTR Monoclonal 570 Gift from Cystic Fibrosis Foundation N/A Alexa Fluor Plus 555 Phalloidin Thermo Fisher Cat#A30106 Goat anti-mouse Alexa Fluor 647 Thermo Fisher Cat#A21235; RRID:AB_2535804 Bacterial and virus strains Escherichia coli SM10 helper pBF13, Ampicillin resistant Søren Molin Lab N/A E. coli HB101 helper pRK600, Chloramphenicol resistant Søren Molin Lab N/A E. coli mini-tn7-sfGFP, Gentamicin resistant This study N/A P. aeruginosa PAO1, sfGFP tagged Original strain from DSMZ collection, tagged in this study DSM22644, sfGFP tagged PA14, sfGFP tagged Original strain from DSMZ collection, tagged in this study DSM19882, sfGFP tagged C Clone, sfGFP tagged Original strain from DSMZ collection, tagged in this study DSM29238, sfGFP tagged P. aeruginosa type III secretion (pscC), sfGFP tagged Pedersen et al. 17 N/A P. aeruginosa clinical strains, sfGFP tagged This study See Table S1 Biological samples Nasal swabs, lung biopsies, polyps from CF donors CF Clinic, Rigshospitalet See Table S2 Nasal swabs from non-CF donors Healthy volunteers See Table S2 Chemicals, peptides, and recombinant proteins Primocin InvivoGen Cat#ant-pm-05 Gentamicin/Amphotericin solution Gibco Cat#10184583 Penicillin/Streptomycin Gibco Cat#15140122 PneumaCult TM -Ex Plus Basal Medium and supplements STEMCELL Technologies Cat#05040 Hydrocortisone Stock Solution STEMCELL Technologies Cat#07925 ROCK inhibitor (Y-27632) Tocris Bioscience Cat#1254 TrypLE Gibco Cat#12563011 Collagen I, rat tail Gibco Cat#A1048301 PneumaCult TM -ALI Basal Medium and supplements STEMCELL Technologies Cat#05001 Heparin Solution STEMCELL Technologies Cat#07980 Elexacaftor MedChemExpress Cat#VX-445 Tezacaftor Selleck Chemicals LLC Cat#VX-661 Ivacaftor Selleck Chemicals LLC Cat#VX-770 Forskolin TargetMol Cat#T2939 Genistein TargetMol Cat#T1737 Coon’s modified Ham’s F12 medium DiagnoCine Cat#AT146 HEPES sodium salt solution Sigma Aldrich Cat#H3662 Amiloride Sigma Aldrich Cat#A7410 PPQ-102 CFTR inhibitor Sigma Aldrich Cat#219677 Gentamicin Salt Sigma Aldrich Cat#G3632 Tobramycin Sigma Aldrich Cat#T4014 Ceftazidime Sigma Aldrich Cat#C3809 (Continued on next page) Cell Reports 45, 116951, February 24, 2026 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Ciprofloxacin Sigma Aldrich Cat#17850 Triton X-100 Invitrogen Cat#HFH10 Saponin Thermo Fisher Cat#A18820.14 Phosphate Buffered Saline Gibco Cat#10010023 Bovine Serum Albumin Sigma Aldrich Cat#05470-5G VECTASHIELD® Antifade Mounting Medium VWR Cat#VECTH-1000 RNA protect Cell Reagent Qiagen Cat#76526 Lysozyme Thermo Fisher Cat#89833 β-mercaptoethanol Sigma Aldrich Cat#444203 DNAse I Invitrogen Cat#EN0521 DAPI Thermo Fisher Cat#62248 Critical commercial assays Human IL-8/CXCL8 DuoSet ELISA kit Bio-Techne Cat#DY208 CyQUANT TM LDH Cytotoxicity Assay Thermo Fisher Cat#C20301 Qiagen RNeasy Plus Mini kit Qiagen Cat#74134 Qubit® RNA BR Assay kit Thermo Fisher Cat#Q10210 RNA 6000 Nano kit Agilent Cat#5067-1511 Illumina Stranded Total RNA Prep with Ribo-Zero Plus kit Illumina Cat#20040529 Illumina® RNA UD Indexes Set A, Ligation (96 Indexes, 96 Samples) Illumina Cat#20091655 Deposited data RNA raw sequences (NCBI BioProject) This study PRJNA1153754 Experimental models: Cell lines BCi-NS1.1 cell line Gift from Ronald Crystal Lab (Walters et al. 39 ) N/A Experimental models: Organisms/strains ALI models generated from basal airway cells derived from non-CF and CF and cell line CF Clinic Rigshospitalet and Healthy volunteers See Table S2 Oligonucleotides sfGFP_SacI_For: CATGAGCTCTTGACAA TTAATCATCCGGCTCGTATAATCCTAGG CCGCGACGCATGTTTAG This study N/A sfGFP_KpnI_Rev: GCGAGGTAC CACCCCTGGATTCTCACC This study N/A Software and algorithms JMP Version 17.2 Statistical Discovery LLC https://www.jmp.com/en/offers/ statistical-analysis-software GraphPad Prism Version 10.2.2 GraphPad https://www.graphpad.com/ Computerome Version 2.0 Technical University of Denmark https://computerome.dk/ R Version 2024.04.2 R Studio https://dailies.rstudio.com/version/ 2024.04.2+764/ LasX Version 1.4.4.26810 Leica Microsystems https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/downloads/ Imaris Version 10.1.0 Oxford Instruments https://imaris.oxinst.com/versions/10-1 Other 6.5mm Transwells inserts (0.4 μm pores) Corning Life Sciences Cat#3470 16 Cell Reports 45, 116951, February 24, 2026

    Modification:

    Article Title: Cell-type-independent infection dynamics of clinical Pseudomonas aeruginosa isolates in human airway epithelial models.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies MUC5AC Monoclonal (45M1) Thermo Fisher Cat#MA5-12178; RRID:AB_10978001 CFTR Monoclonal 570 Gift from Cystic Fibrosis Foundation N/A Alexa Fluor Plus 555 Phalloidin Thermo Fisher Cat#A30106 Goat anti-mouse Alexa Fluor 647 Thermo Fisher Cat#A21235; RRID:AB_2535804 Bacterial and virus strains Escherichia coli SM10 helper pBF13, Ampicillin resistant Søren Molin Lab N/A E. coli HB101 helper pRK600, Chloramphenicol resistant Søren Molin Lab N/A E. coli mini-tn7-sfGFP, Gentamicin resistant This study N/A P. aeruginosa PAO1, sfGFP tagged Original strain from DSMZ collection, tagged in this study DSM22644, sfGFP tagged PA14, sfGFP tagged Original strain from DSMZ collection, tagged in this study DSM19882, sfGFP tagged C Clone, sfGFP tagged Original strain from DSMZ collection, tagged in this study DSM29238, sfGFP tagged P. aeruginosa type III secretion (pscC), sfGFP tagged Pedersen et al. 17 N/A P. aeruginosa clinical strains, sfGFP tagged This study See Table S1 Biological samples Nasal swabs, lung biopsies, polyps from CF donors CF Clinic, Rigshospitalet See Table S2 Nasal swabs from non-CF donors Healthy volunteers See Table S2 Chemicals, peptides, and recombinant proteins Primocin InvivoGen Cat#ant-pm-05 Gentamicin/Amphotericin solution Gibco Cat#10184583 Penicillin/Streptomycin Gibco Cat#15140122 PneumaCult TM -Ex Plus Basal Medium and supplements STEMCELL Technologies Cat#05040 Hydrocortisone Stock Solution STEMCELL Technologies Cat#07925 ROCK inhibitor (Y-27632) Tocris Bioscience Cat#1254 TrypLE Gibco Cat#12563011 Collagen I, rat tail Gibco Cat#A1048301 PneumaCult TM -ALI Basal Medium and supplements STEMCELL Technologies Cat#05001 Heparin Solution STEMCELL Technologies Cat#07980 Elexacaftor MedChemExpress Cat#VX-445 Tezacaftor Selleck Chemicals LLC Cat#VX-661 Ivacaftor Selleck Chemicals LLC Cat#VX-770 Forskolin TargetMol Cat#T2939 Genistein TargetMol Cat#T1737 Coon’s modified Ham’s F12 medium DiagnoCine Cat#AT146 HEPES sodium salt solution Sigma Aldrich Cat#H3662 Amiloride Sigma Aldrich Cat#A7410 PPQ-102 CFTR inhibitor Sigma Aldrich Cat#219677 Gentamicin Salt Sigma Aldrich Cat#G3632 Tobramycin Sigma Aldrich Cat#T4014 Ceftazidime Sigma Aldrich Cat#C3809 (Continued on next page) Cell Reports 45, 116951, February 24, 2026 15 .. REAGENT or RESOURCE SOURCE IDENTIFIER Ciprofloxacin Sigma Aldrich Cat#17850 Triton X-100 Invitrogen Cat#HFH10 Saponin Thermo Fisher Cat#A18820.14 Phosphate Buffered Saline Gibco Cat#10010023 Bovine Serum Albumin Sigma Aldrich Cat#05470-5G VECTASHIELD® Antifade Mounting Medium VWR Cat#VECTH-1000 RNA protect Cell Reagent Qiagen Cat#76526 Lysozyme Thermo Fisher Cat#89833 β-mercaptoethanol Sigma Aldrich Cat#444203 DNAse I Invitrogen Cat#EN0521 DAPI Thermo Fisher Cat#62248 Critical commercial assays Human IL-8/CXCL8 DuoSet ELISA kit Bio-Techne Cat#DY208 CyQUANT TM LDH Cytotoxicity Assay Thermo Fisher Cat#C20301 Qiagen RNeasy Plus Mini kit Qiagen Cat#74134 Qubit® RNA BR Assay kit Thermo Fisher Cat#Q10210 RNA 6000 Nano kit Agilent Cat#5067-1511 Illumina Stranded Total RNA Prep with Ribo-Zero Plus kit Illumina Cat#20040529 Illumina® RNA UD Indexes Set A, Ligation (96 Indexes, 96 Samples) Illumina Cat#20091655 Deposited data RNA raw sequences (NCBI BioProject) This study PRJNA1153754 Experimental models: Cell lines BCi-NS1.1 cell line Gift from Ronald Crystal Lab (Walters et al. 39 ) N/A Experimental models: Organisms/strains ALI models generated from basal airway cells derived from non-CF and CF and cell line CF Clinic Rigshospitalet and Healthy volunteers See Table S2 Oligonucleotides sfGFP_SacI_For: CATGAGCTCTTGACAA TTAATCATCCGGCTCGTATAATCCTAGG CCGCGACGCATGTTTAG This study N/A sfGFP_KpnI_Rev: GCGAGGTAC CACCCCTGGATTCTCACC This study N/A Software and algorithms JMP Version 17.2 Statistical Discovery LLC https://www.jmp.com/en/offers/ statistical-analysis-software GraphPad Prism Version 10.2.2 GraphPad https://www.graphpad.com/ Computerome Version 2.0 Technical University of Denmark https://computerome.dk/ R Version 2024.04.2 R Studio https://dailies.rstudio.com/version/ 2024.04.2+764/ LasX Version 1.4.4.26810 Leica Microsystems https://www.leica-microsystems. com/products/microscopesoftware/p/leica-las-x-ls/downloads/ Imaris Version 10.1.0 Oxford Instruments https://imaris.oxinst.com/versions/10-1 Other 6.5mm Transwells inserts (0.4 μm pores) Corning Life Sciences Cat#3470 16 Cell Reports 45, 116951, February 24, 2026



    Similar Products

    f12 medium diagnocine cat  (TargetMol)
    94
    TargetMol f12 medium diagnocine cat
    F12 Medium Diagnocine Cat, supplied by TargetMol, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/f12+medium+diagnocine+cat/Coagulation+factor+XII+Protein%2C+Human%2C+Recombinant/pm41666013-611-255-250
    Average 94 stars, based on 1 article reviews
    f12 medium diagnocine cat - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier

    Image Search Results